Question Details

[answered] Lab Procedure 1. 10. ll. 12. 13. First, you will prepare a


Lab Procedure 1. 10. ll. 12. 13. First, you will prepare a sample of known tiger DNA that you will compare your unknown samples to. (Notice that your unknown samples are contained in four microcentrifuge tubes in the tube rack. Roll over the tubes to see which DNA samples they contain.) Drag an empty microcentrifuge tube from the Empty Tubes jar to the tube rack. Hover over the tube, and then click in the blank gray box on the face of the tube rack so you can label the tube. Use ?Tiger DNA" or something similar as your label. In the Species Selector, the tiger will already be selected for you. Click on the pipette icon below the species list. You now have a pipette loaded with tiger DNA. Hover over your newly labeled Tiger DNA tube until the pipette straightens up. Click to put the DNA into the tube. Once the pipette is leaning to the right, you?ll know that the DNA is in the tube. (For help using the pipette, watch this video.) Now you will add PCR reagents to your Tiger DNA tube. Do this by clicking on the Taq jar, which will give you a loaded pipette. Then hover over the tube and click (as you did with the DNA pipette) to insert the reagent into the tube. Do the same with dNTPs tag. (Make sure you do not add ?dNTPs.") Note: These PCR reagents have already been added to the other four tubes containing your unknowns. You will now add primers to each of your samples that are specific to the ATP6 gene, which will serve as the point of comparison between your tiger DNA sample and the DNA extracted from the unidentified samples. Click on the small projector behind the tube rack to open the Primer Controls. For each of the primers shown below, copy and paste them one at a time into the blank field at the bottom of the primer selector. Click Add for each one. Now they will appear at the top of the primer menu with asterisks (*). Left primer atgaacgaaaatctattcacc Right primer ttaagtattatcatgtaa Select one of the primers you just added to the list, click the pipette icon beneath the list, and use the loaded pipette to add that primer to the first tube in the rack. Then reload the primer pipette and add it to the next tube. (To reload, simply click the pipette?s tip on the pipette icon below the list of primers.) Repeat until you have added the first primer to all of the tubes. Repeat with the second primer. Be sure to add both primers to all of the tubes. Finally, use PCR to amplify the ATP6 gene from each DNA sample. Drag each tube into the PCR machine. Close the lid and click the green arrow to start the machine. This process, called polymerase chain reaction (PCR), makes multiple copies of the particular gene you are targeting ?in this case, ATP6. (For help running the PCR, watch this video.) PCR takes a while, so click on the arrows on the main lab clock to advance time by a little more than 3 hours. You will now see that the PCR reads ?complete," and that 35 cycles have been performed. Drag the tubes back to the tube rack. Describe what is contained in each of your sample tubes at this point. ANSWER:
This text was automatically generated from the attachment. Please refer to the attachment to view this question.
This question was created from Molecular_Is an Endangered Species Being Traded Illegally_Worksheet.doc https://www.aceyourstudies.com/file/14050605/Molecular-Is-an-Endangered-Species-Being-Traded-Illegally-Worksheetdoc/?focusQaId=10149000

 


Solution details:
STATUS
Answered
QUALITY
Approved
ANSWER RATING

This question was answered on: Sep 18, 2020

PRICE: $15

Solution~0001013034.zip (25.37 KB)

Buy this answer for only: $15

This attachment is locked

We have a ready expert answer for this paper which you can use for in-depth understanding, research editing or paraphrasing. You can buy it or order for a fresh, original and plagiarism-free copy from our tutoring website www.aceyourhomework.com (Deadline assured. Flexible pricing. TurnItIn Report provided)

Pay using PayPal (No PayPal account Required) or your credit card . All your purchases are securely protected by .
SiteLock

About this Question

STATUS

Answered

QUALITY

Approved

DATE ANSWERED

Sep 18, 2020

EXPERT

Tutor

ANSWER RATING

GET INSTANT HELP/h4>

We have top-notch tutors who can do your essay/homework for you at a reasonable cost and then you can simply use that essay as a template to build your own arguments.

You can also use these solutions:

  • As a reference for in-depth understanding of the subject.
  • As a source of ideas / reasoning for your own research (if properly referenced)
  • For editing and paraphrasing (check your institution's definition of plagiarism and recommended paraphrase).
This we believe is a better way of understanding a problem and makes use of the efficiency of time of the student.

NEW ASSIGNMENT HELP?

Order New Solution. Quick Turnaround

Click on the button below in order to Order for a New, Original and High-Quality Essay Solutions. New orders are original solutions and precise to your writing instruction requirements. Place a New Order using the button below.

WE GUARANTEE, THAT YOUR PAPER WILL BE WRITTEN FROM SCRATCH AND WITHIN YOUR SET DEADLINE.

Order Now